The full text of this article hosted at iucr.org is unavailable due to technical difficulties.

Free Access

Diet‐Induced Changes in Stearoyl‐CoA Desaturase 1 Expression in Obesity‐Prone and ‐Resistant Mice

Charlie C. Hu

Division of Endocrinology, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana 46285

Search for more papers by this author
Keyun Qing

Division of Endocrinology, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana 46285

Search for more papers by this author
Yanyun Chen

Corresponding Author

Division of Endocrinology, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana 46285

Lilly Corporate Center, DC 0545, Eli Lilly and Company, Indianapolis, IN 46285. E‐mail:

Search for more papers by this author
First published: 06 September 2012
Cited by: 50

According to U.S. code, all journals requesting payment of author page charges in order to defray the cost of publication are required to publish a disclaimer. This article must, therefore, be marked “advertisement” in compliance with U.S.C. Section 1734 solely to indicate this fact.

Abstract

Objective: To investigate stearoyl‐coenzyme A desaturase (SCD) 1 expression in obesity‐prone C57BL/6 mice and in obesity‐resistant FVB mice to explore the relationship of SCD1 expression and susceptibility to diet‐induced obesity.

Research Methods and Procedures: Nine‐week‐old C57BL/6 and FVB mice were fed either a high‐ or low‐fat diet for 8 weeks. Body weight and body composition were measured before and at weeks 4 and 8 of the study. Energy expenditure was measured at weeks 1 and 5 of the study. Hepatic SCD1 mRNA was measured at 72 hours and at the end of study. Plasma leptin and insulin concentrations were measured at the end of study.

Results: When C57BL/6 mice were switched to a calorie‐dense high‐fat diet, animals gained significantly more body weight than those maintained on a low‐calorie density diet primarily due to increased fat mass accretion. Fat mass continued to accrue throughout 8 weeks of study. Increased calorie intake did not account for all weight gain. On the high‐fat diet, C57BL/6 mice decreased their energy expenditure when compared with mice fed a low‐fat diet. In response to 8 weeks of a high‐fat diet, SCD1 gene expression in liver increased >2‐fold. In contrast, ing a high‐fat diet did not change body weight, energy expenditure, or SCD1 expression in FVB mice.

Discussion: Our study showed that a high‐fat hypercaloric diet increased body adiposity first by producing hyperphagia and then by decreasing energy expenditure of mice susceptible to diet‐induced obesity. Consumption of a high‐fat diet in species predisposed to obesity selectively increased SCD1 gene expression in liver.

Introduction

Stearoyl‐coenzyme A (CoA)1 desaturase (SCD) catalyzes conversion of saturated fatty acids, stearoyl‐CoA (18:0) and palmitoyl‐CoA (16:0), to monounsaturated fatty acids, oleoyl‐CoA (18:1) and pamitoleoyl‐CoA (16:1), respectively. These fatty acids are components of membrane phospholipids, triglycerides, and cholesterol esters. Changes in SCD activity ultimately change membrane fluidity, lipoprotein metabolism, and adiposity (1). Three SCD isoforms (SCD1 to 3) have been identified in mice and two (SCD1 and 2) in rats. So far, only the SCD1 gene is found in humans. SCD1 is expressed mainly in liver and adipose tissue (2, 3); SCD2 is expressed constitutively in brain and can be induced in kidney, lung, and adipose tissue in mice consuming a fat‐free and carbohydrate‐rich diet (3); and SCD3 is expressed exclusively in mouse skin (4). SCD1 gene expression is regulated by multiple factors. SCD1 is up‐regulated by carbohydrate‐ and cholesterol‐rich diets, iron overload, insulin, peroxisome proliferator, and glucocorticoids, and down‐regulated by glucagon, polyunsaturated fatty acids, thyroid hormone, vitamin A, retinoic acid, and thiazolidinedione drugs (for review, see (1)). High SCD1 activity has been implicated in several diseases such as obesity, atherosclerosis, diabetes, and cancer.

Recent studies of naturally occurring SCD1‐deficient Asebia mice and laboratory‐created SCD1 knockout mice (SCD1−/−) have provided insight on physiological roles that SCD1 plays. SCD1−/− mice are lean, hyperphagic, sensitive to insulin, present with atrophy of sebaceous and meibomian glands, and are protected from obesity (5, 6). Triglyceride levels are greatly reduced in Asebia mice and SCD1−/− mice. Phenotypes of the SCD1−/− mice suggest direct antisteatotic effects of SCD1 deficiency on tissues. Furthermore, high SCD1 activity is also associated with hypertriglyceridemia in humans and mice (7). Because SCD1 activity is positively correlated with plasma triglyceride levels, we hypothesized that SCD1 gene expression would correlate with adiposity. Consumption of a calorie‐dense diet is associated with an increase in body adiposity in obesity‐prone mice, not in obesity‐resistant mice (8). We predicted that SCD1 gene expression would increase in obesity‐prone mice, not in obesity‐resistant mice. In the work described here, we investigated SCD1 expression in two strains of mice with different sensitivity to high‐fat diets. C57BL/6 mice develop obesity on high‐fat diets, whereas FVB mice are resistant to diet‐induced obesity. The results indicated that dietary fat specifically increased hepatic SCD1 expression in obesity‐prone C57BL/6 mice but not in obesity‐resistant FVB mice. This difference in the response of SCD1 gene to dietary fat in the two lines of mice paralleled changes in adiposity.

Research Methods and Procedures

Animal Care

Male mice of both strains were purchased from Harlan Sprague‐Dawley (Indianapolis, IN) at 7 weeks of age. The animals were individually housed in a temperature‐controlled (24 °C) facility with a 12‐hour light/dark cycle (lights on at 10 pm). All mice had free access to water and food. Mice were allowed 2 weeks to acclimate to the new environment; then, they were divided into two groups at 9 weeks of age so that each group had similar body weight. One group of mice was fed a low‐fat chow (12% fat calories, Purina 5001 chow; Ralston Purina Co., St. Louis, MO), and the other group was fed a high‐fat diet (40% caloric fat content, TD95217; Teklad, Madison, WI) (Table 1). All animals used in this study were treated in compliance with NIH guidelines (NIH Publication No. 86‐23, 1985). The protocol was approved by the institution's animal care and use committee.

Table 1. Nutrient information of low‐ and high‐fat diets
Low fat High fat
Calories (kg) 3630 4380
Calories from fat (%) 12 40
 Saturated (g/kg) 16.7 54.2
 Monounsaturated (g/kg) 17.3 67.9
 Polyunsaturated (g/kg) 16.5 32
Cholesterol (mg/kg) 207 156
Total carbohydrate (g/kg) 548 531

Measurement of Energy Expenditure

Energy expenditure was calculated from oxygen consumed and CO2 produced, measured by indirect calorimetry as described previously (9).

Body Composition Analysis

Fat mass was analyzed by nuclear magnetic resonance using an Echo Medical System (Houston, TX) instrument. Body composition was analyzed before and at 4 and 8 weeks after diet assignment. Fat mass was measured, and the difference between that and total body mass was calculated to determine fat‐free mass.

Real‐Time Reverse Transcription‐Polymerase Chain Reaction (PCR)

Livers were dissected from mice at 72 hours and at completion of study, and total RNA was extracted using the RNA Easy mini kit (QIAGEN, Valencia, CA). cDNA was synthesized from 1 μg of total RNA using random hexamers and SuperScript first‐strand synthesis system (Invitrogen, Carlsbad, CA). SCD1 gene expression was measured with real‐time PCR in an ABI PRISM 7700 Sequence Detection System instrument (Perkin‐Elmer Corp., Foster City, CA) with reverse‐transcribed cDNA equivalent to 10 ng of total RNA. All samples were assayed in triplicate and assayed twice. The β‐actin gene was used as a normalizer. SCD1 expression level was expressed as the ratio of SCD1 to β‐actin. The expression level of SCD1 in mice fed the low‐fat diet was arbitrarily given value of 100. Primers and probes for β‐actin and SCD1 were designed from the published sequences and were as follows: 5′‐TCCTGGCCTCACTGTCCAC (β‐actin sense), 5′‐GGGCCGGACTCATCGTACT (β‐actin antisense), 6FAM‐tccagcagatgtggatcagcaagca‐TAMRA (β‐actin probe), 5′‐CCTCCGGAAATGAACGAGAG (SCD1 sense), 5′‐CAGGACGGATGTCTTCTTCCA (SCD1 antisense), and 6FAM‐aggtgaagacggtgcccctccac‐TAMRA (SCD1 probe).

Biochemical Analyses

Trunk blood was collected from mice by decapitation at completion of study. Plasma samples were analyzed for leptin and insulin concentration using radioimmunoassay kits (Linco Research, St. Louis, MO).

Statistical Analysis

All data were expressed as mean ± SE. Statistical analyses were performed by one‐way ANOVA with post hoc testing using Tukey's t test.

Results

To investigate whether diet regulates SCD1 gene expression, we recapitulated the effect of a calorie‐dense diet on body weight in obesity‐prone C57BL/6 and obesity‐resistant FVB mice. Mice were fed a typical chow (Purina 5001) until 9 weeks of age and then were assigned to the high‐fat diet (TD95217) or continued on the low‐fat chow for 8 weeks. C57BL/6 mice fed the high‐fat diet consumed 19% more calories during the first 4 weeks of the study (Figure 1A). The initial body weight of C57BL/6 mice was 26.2 grams for both groups (Figure 1B). C57BL/6 mice fed the high‐fat diet weighed significantly more than those on the low‐fat chow after 4 weeks (36.7 ± 2.1 vs. 28.5 ± 0.4 grams, respectively; p < 0.005). Mice on the high‐fat diet continued to gain weight and reached an average body weight of 41.4 ± 1.8 grams after 8 weeks, whereas mice fed the low‐fat chow weighed 30.4 ± 0.7 grams (p < 0.001) (Figure 1B). Cumulative calorie consumption of high‐fat diet at 8 weeks was significantly higher than that of low‐fat diet. However, the difference between the two diet groups at 8 weeks is the same as that at 4 weeks. So, during the second 4 weeks of study, calorie intake was similar in both diet groups (Figure 1A). In contrast, FVB mice were not hyperphagic when fed the high‐fat diet (Figure 1C), and their calorie intake was similar to that of C57BL/6 mice fed the low‐fat diet (Figure 1 A and C). FVB mice fed either diet gained very little body weight during the 8 weeks of study (Figure 1D). Body composition analysis of C57BL/6 mice by nuclear magnetic resonance showed that high‐fat diet‐induced weight gain was primarily accounted for by increased fat mass (Figure 2A). After 4 weeks on the calorie‐dense diet, the fat mass increased from 3 ± 0.2 to 10.9 ± 1.1 grams (p < 0.001). By the end of 8 weeks, adiposity of the high‐fat group was 280% that of the low‐fat group (14.6 ± 0.9 vs. 5.2 ± 0.6 grams; p < 0.001; Figure 2A). Lean mass of both C57BL/6 diet groups was similar during the study period (Figure 2B).

Cumulative calorie intake (A) and body weight (B) of C57BL/6 mice and cumulative calorie intake (C) and body weight (D) of FVB mice fed either a high‐ or low‐fat diet. Values are means ± SE of seven mice/group. *p < 0.05 when comparing diet groups.

Fat (A) and lean (B) body mass of C57BL/6 mice after 4 and 8 weeks on the high‐fat diet. Values are means ± SE of seven mice/group. * p < 0.05 when comparing diet groups.

Indirect calorimetry was performed at 1 and 5 weeks after diet change in C57BL/6 and FVB mice. Feeding the high‐fat diet for 1 week did not change energy expenditure when compared with that of mice fed the low‐fat diet in both strains (Figure 3 A and D). Feeding the high‐fat diet to C57BL/6 mice for 5 weeks significantly decreased energy expenditure during the dark photoperiod when compared with the low‐fat diet group, whereas there was no difference between groups in basal energy expenditure during the light photoperiod (Figure 3 B and C). In contrast, FVB mice showed no change in energy expenditure 5 weeks after switching to the high‐fat diet (Figure 3 E and F).

Energy expenditure of C57BL/6 mice after 1 (A) and 5 (B) weeks on the high‐fat diet. (C) Average energy expenditure during dark and light photoperiods of C57BL/6 mice at 5 weeks of study. Energy expenditure of FVB mice after 1 (D) and 5 (E) weeks on the high‐fat diet. (F) Average energy expenditure during dark and light photoperiods of FVB mice at 5 weeks of study. Values are means ± SE of five mice/group. * p < 0.05 when comparing diet groups.

Liver samples were collected at 72 hours post‐dietary change and at the end of the 8‐week study. SCD1 expression in C57BL/6 mice, analyzed by real‐time PCR and normalized to β‐actin, increased 40% at 72 hours post‐dietary change (Figure 4A). Its expression increased >2‐fold (227.5 ± 17.6 vs. 100 ± 6, p < 0.001) at completion of the 8‐week study (Figure 4B). SCD1 expression was not significantly affected by age in the low‐fat diet mice. At the end of the study (17 weeks of age), SCD1 level was slightly higher (19%) than at 8 weeks of age (data not shown). Every mouse in the high‐fat diet group had more fat mass and higher level of SCD1 expression than those in the low‐fat diet group (Figure 4C). No difference was observed in SCD1 mRNA expression between diet groups in the FVB mouse strain at 72 hours (data not shown) or 8 weeks (Figure 5).

(A) Relative expression of SCD1 mRNA in the liver of C57BL/6 mice after 72 hours (A) and 8 weeks (B) on the high‐fat diet. Values are means ± SE of seven mice/group. * p < 0.001 when comparing diet groups. Mean value of the low‐fat diet group was designated to be 100. (C) Correlation of SCD1 mRNA level with fat mass in C57BL/6 mice.

Relative expression of SCD1 mRNA in the liver of FVB mice after 8 weeks on the high‐fat diet. Values are means ± SE of seven mice/group.

Plasma samples were collected at the end of the study. C57BL/6 mice on the high‐fat diet exhibited significantly higher leptin and insulin levels compared with low‐fat diet controls (Table 2). Leptin and insulin levels tended to increase in the high‐fat‐fed FVB mice; however, this difference did not reach statistical significance (Table 2).

Table 2. Plasma leptin and insulin levels at the end of the study
Low fat High fat
Leptin (ng/ml)
 C57BL/6 7.6 ± 2.7 24.2 ± 4.8*
 FVB 4.6 ± 0.3 13.1 ± 3.0
Insulin (ng/ml)
 C57BL/6 1.1 ± 0.2 10.1 ± 4.9*
 FVB 1.0 ± 0.3 1.6 ± 0.4
  • Values represent the mean ± SE of eight mice per group.
  • * p < 0.05 vs. low‐fat control of the corresponding strain.

Discussion

Our results are consistent with the observations that C57BL/6 is an obesity‐prone strain and that the FVB strain is resistant to weight gain when fed a calorie‐dense diet (8). Hypercaloric ing is thought to be the main contributor to the onset of obesity in the obesity‐prone C57BL/6 strain. It has been shown that C57BL/6 mice are associated with higher hypothalamic neuropeptide (NPY) mRNA on high‐fat diet challenge (10, 11). In contrast, on the high‐fat diet, NPY mRNA significantly decreased, and proopiomelanocortin mRNA significantly increased in obesity‐resistant mice (12). Differential regulation of hypothalamic neuropeptides may be critical in regulating calorie intake of mouse strains on the high‐fat diet. Differential regulation in thermogenesis may also contribute to different sensitivity to diet‐induced adiposity. UCP2 expression in white adipose tissue and UCP1 expression in brown adipose tissue are found to be elevated in the obesity‐resistant strain, not in the obesity‐prone strain (11, 13). Data presented in this study demonstrated that C57BL/6 had significantly higher calorie intake and normal metabolic rate in the initial 4 weeks after switching from a low‐ to high‐fat diet. Thus, weight gain in this period appears to be the result of hyperphagia. In the following 4 weeks, C57BL/6 mice showed significantly decreased energy expenditure, whereas calorie intake was normal. Increased body mass gain in this period seems to be the result of decreased metabolic rate. Diet‐induced weight gain in C57BL/6 mice is due primarily to increased fat mass accretion. In contrast, FVB mice had no increase in body weight, calorie intake, or metabolic rate. A study by Takahashi showed that obesity‐prone mice were less responsive to an increase in leptin in the fed state. Robust response to high leptin level in obesity‐resistant mice is associated with suppression of NPY mRNA (11). An elevated leptin level in FVB mice on diet change would be expected to reduce the expression of NPY gene and, thus, prevent hyperphagia, whereas this response was blunted in the C57BL/6 mice.

We observed that SCD1 mRNA levels were increased in C57BL/6 but not in FVB mice when fed a high‐fat diet. Nutritional regulation of hepatic SCD1 expression has been previously described. In particular, it has been reported that ing fasted mice a fat‐free high‐carbohydrate diet induced SCD1 mRNA. This induction of gene expression is repressed by supplementing the fat‐free diet with triacylglycerides containing polyunsaturated fatty acids (14). SCD1 synthesis in rat liver is regulated positively by saturated fatty acids and negatively by polyunsaturated fatty acids (15, 16, 17). The high‐fat diet used in this study was high in saturated and unsaturated fats (Table 1). The net effect of the diet on SCD1 expression is unclear. Data in the study showed that induction of SCD1 mRNA occurred at 72 hours (Figure 4A). It suggests that initial hyperphagia contributes some degree to induction of SCD1 expression. Other explanations are also possible. Diet‐induced adiposity may also contribute to further induction of SCD1 gene.

Expression of liver SCD1 is also influenced by a variety of signals such as insulin, glucagons, glucocorticoids, and peroxisome proliferators. Numerous studies have demonstrated that chronic ing of a high‐fat hypercaloric diet induces obesity, hyperinsulimia, and hyperlipidemia in obesity‐prone rodents (18, 19). DNA microarray analysis has revealed up‐regulation of a number of genes involved in lipid metabolism such as SCD1 and glycerol‐3‐phosphate dehydrogenase in diet‐induced obese rats (20). Our observation of obesity, hyperinsulimia, and hyperlipidemia and induction of SCD1 in C57BL/6 mice after high‐fat diet ing is in agreement with these reports. Given these data, we speculate that high saturated dietary fat in the study may be responsible for increased SCD1 expression and initial obese phenotype in C57BL/6 mice. As a consequence of increased adiposity, insulin level is elevated in these mice, which, in turn, sustains elevated SCD1 expression.

Several studies have suggested that leptin plays an important role in regulating SCD1 expression. Cohen et al. have presented evidence that SCD1 mRNA level and its activity were increased in ob/ob mice and were reduced in these animals by leptin treatment (21). Kakuma et al. reported that adenovirus‐induced hyperleptinemia reduced the SCD1 gene by 96% in Zucker lean rats (22). Leptin administration and adenovirus‐induced hyperleptinemia will reduce body adiposity. These results are consistent with our conclusions that body adiposity parallels SCD1 expression level. Kakuma et al. also reported that high‐fat ing lowered hepatic SCD1 mRNA by 80% in Sprague‐Dawley rats (22). We have observed induction of SCD1 gene in a strain of rat susceptible to diet‐induced obesity similar to what we reported here (unpublished data, C. Hu and Y. Chen). The difference may be due to strain difference.

Our study demonstrated that the high‐fat diet failed to induce SCD1 expression in FVB mice. FVB mice did not change body weight, energy expenditure, or SCD1 expression after consuming the diet for 8 weeks. This is the first study to show that the traditionally regarded nutrient‐sensitive SCD1 gene is differentially regulated in different mouse strains. These data suggest that SCD1 expression is sensitive to dietary factors only in strains sensitive to dietary fat. We speculate that SCD1 mRNA inducibility may be the principal determinant in prediction diet‐induced obesity.

In conclusion, a high‐fat hypercaloric diet increases body adiposity first by producing hyperphagia and then by decreasing energy expenditure of mice susceptible to diet‐induced obesity. Dietary composition and genetic background are two major factors regulating SCD1 expression in liver.

Acknowledgment

There was no funding/outside support for this study. The authors thank Mark Heiman and Craig Hammond for critical review of this manuscript.

    Footnotes

    • 1 Nonstandard abbreviations: CoA, coenzyme A; SCD, stearoyl‐coenzyme A desaturase; PCR, polymerase chain reaction; NPY, neuropeptide Y.

      Number of times cited: 50

      • , Differential response of rat strains to obesogenic diets underlines the importance of genetic makeup of an individual towards obesity, Scientific Reports, 7, 1, (2017).
      • , Choline Supplementation Normalizes Fetal Adiposity and Reduces Lipogenic Gene Expression in a Mouse Model of Maternal Obesity, Nutrients, 9, 8, (899), (2017).
      • , Metformin Affects Cortical Bone Mass and Marrow Adiposity in Diet-Induced Obesity in Male Mice, Endocrinology, 10.1210/en.2017-00299, 158, 10, (3369-3385), (2017).
      • , Role of MCP-1 on inflammatory processes and metabolic dysfunction following high-fat ings in the FVB/N strain, International Journal of Obesity, 40, 5, (844), (2016).
      • , Anti-obesity Effect of Dioscorea oppositifolia Extract in High-Fat Diet-Induced Obese Mice and Its Chemical Characterization, Biological & Pharmaceutical Bulletin, 39, 3, (409), (2016).
      • , High-Fat, High-Calorie Diet Enhances Mammary Carcinogenesis and Local Inflammation in MMTV-PyMT Mouse Model of Breast Cancer, Cancers, 7, 4, (1125), (2015).
      • , High oleic/stearic fatty-acid desaturation index in cord plasma from infants of mothers with gestational diabetes, Journal of Perinatology, 34, 5, (357), (2014).
      • , Mex3c mutation reduces adiposity partially through increasing physical activity, Journal of Endocrinology, 221, 3, (457), (2014).
      • , Adipose tissue stearoyl-CoA desaturase 1 index is increased and linoleic acid is decreased in obesity-prone rats fed a high-fat diet, Lipids in Health and Disease, 12, 1, (2), (2013).
      • , Prenatal stress increases the obesogenic effects of a high-fat-sucrose diet in adult rats in a sex-specific manner, Stress, 16, 2, (220), (2013).
      • , AMPK and Insulin Action - Responses to Ageing and High Fat Diet, PLoS ONE, 8, 5, (e62338), (2013).
      • , Increased adipose tissue hypoxia and capacity for angiogenesis and inflammation in young diet-sensitive C57 mice compared with diet-resistant FVB mice, International Journal of Obesity, 37, 6, (853), (2013).
      • , Fatty Liver Is Associated with Transcriptional Downregulation of Stearoyl-CoA Desaturase and Impaired Protein Dimerization, PLoS ONE, 8, 9, (e76912), (2013).
      • , Impact of Dietary Dairy Polar Lipids on Lipid Metabolism of Mice Fed a High-Fat Diet, Journal of Agricultural and Food Chemistry, 61, 11, (2729), (2013).
      • , AMP‐activated protein kinase α2 is an essential signal in the regulation of insulin‐stimulated fatty acid uptake in control‐fed and high‐fat‐fed mice, Experimental Physiology, 97, 5, (603-617), (2012).
      • , Factors Predicting Nongenetic Variability in Body Weight Gain Induced by a High‐Fat Diet in Inbred C57BL/6J Mice, Obesity, 20, 6, (1179-1188), (2012).
      • , The ketone body  -hydroxybutyric acid influences agouti-related peptide expression via AMP-activated protein kinase in hypothalamic GT1-7 cells, Journal of Endocrinology, 213, 2, (193), (2012).
      • , Differential expression of liver proteins between obesity-prone and obesity-resistant rats in response to a high-fat diet, British Journal of Nutrition, 106, 04, (612), (2011).
      • , P-glycoprotein Dysfunction Contributes to Hepatic Steatosis and Obesity in Mice, PLoS ONE, 6, 9, (e23614), (2011).
      • , Body weight and energy homeostasis was not affected in C57BL/6 mice fed high whey protein or leucine-supplemented low-fat diets, European Journal of Nutrition, 50, 6, (479), (2011).
      • , Wnt10b deficiency results in age‐dependent loss of bone mass and progressive reduction of mesenchymal progenitor cells, Journal of Bone and Mineral Research, 25, 10, (2138-2147), (2010).
      • , Polyunsaturated fatty acids are involved in regulatory mechanism of fatty acid homeostasis via daf-2/insulin signaling in Caenorhabditis elegans, Molecular and Cellular Endocrinology, 323, 2, (183), (2010).
      • , Role of β-hydroxybutyric acid in the central regulation of energy balance, Appetite, 54, 3, (450), (2010).
      • , Evidence for a tumor promoting effect of high-fat diet independent of insulin resistance in HER2/Neu mammary carcinogenesis, Breast Cancer Research and Treatment, 10.1007/s10549-009-0586-8, 122, 3, (647-659), (2009).
      • , High fat diet altered the mechanism of energy homeostasis induced by nicotine and withdrawal in C57BL/6 mice, Molecules and Cells, 30, 3, (219), (2010).
      • , Selecting exercise regimens and strains to modify obesity and diabetes in rodents: an overview, Clinical Science, 119, 2, (57), (2010).
      • , Differential effects of sucrose and fructose on dietary obesity in four mouse strains, Physiology & Behavior, 101, 3, (331), (2010).
      • , Reduced AMP-activated protein kinase activity in mouse skeletal muscle does not exacerbate the development of insulin resistance with obesity, Diabetologia, 52, 11, (2395), (2009).
      • , Beyond triglyceride synthesis: the dynamic functional roles of MGAT and DGAT enzymes in energy metabolism, American Journal of Physiology-Endocrinology and Metabolism, 297, 1, (E10), (2009).
      • , Sequential Responses to High‐fat and High‐calorie Feeding in an Obese Mouse Model, Obesity, 16, 5, (972-978), (2012).
      • , Ablation of AMP-Activated Protein Kinase  2 Activity Exacerbates Insulin Resistance Induced by High-Fat Feeding of Mice, Diabetes, 57, 11, (2958), (2008).
      • , Role of stearoyl-CoA desaturases in obesity and the metabolic syndrome, International Journal of Obesity, 32, 7, (1076), (2008).
      • , Dephosphorylation of Translation Initiation Factor 2α Enhances Glucose Tolerance and Attenuates Hepatosteatosis in Mice, Cell Metabolism, 10.1016/j.cmet.2008.04.011, 7, 6, (520-532), (2008).
      • , Changes in plasma fatty acid composition after intake of a standardised breakfast in prepubertal obese children, British Journal of Nutrition, 99, 04, (2008).
      • , Diacylglycerol acyltransferases: Potential roles as pharmacological targets, Pharmacology & Therapeutics, 118, 3, (295), (2008).
      • , Elongation and Desaturation of Fatty Acids are Critical in Growth, Lipid Metabolism and Ontogeny of Caenorhabditis elegans, The Journal of Biochemistry, 144, 2, (149), (2008).
      • , Metabolic Syndrome Affects Fatty Acid Composition of Plasma Lipids in Obese Prepubertal Children, Lipids, 43, 8, (723-732), (2008).
      • , Sustained Weight Loss After Roux-en-Y Gastric Bypass Is Characterized by Down Regulation of Endocannabinoids and Mitochondrial Function, Annals of Surgery, 247, 5, (779), (2008).
      • , Effects of Phosphatidylethanol on Mouse Adipocyte Differentiation and Expression of Stearoyl‐CoA Desaturase 1, Alcoholism: Clinical and Experimental Research, 31, 3, (376-382), (2007).
      • , Increasing Dietary Leucine Intake Reduces Diet-Induced Obesity and Improves Glucose and Cholesterol Metabolism in Mice via Multimechanisms, Diabetes, 56, 6, (1647), (2007).
      • , Hyperlipidemia and lipid peroxidation are dependent on the severity of chronic intermittent hypoxia, Journal of Applied Physiology, 102, 2, (557), (2007).
      • , Resistance to obesity and resistance to atherosclerosis: Is there a metabolic link?, Nutrition, Metabolism and Cardiovascular Diseases, 17, 7, (554), (2007).
      • , The role of the endocannabinoid system in the control of energy homeostasis, International Journal of Obesity, 30, S1, (S33), (2006).
      • , The Fasting-induced Adipose Factor/Angiopoietin-like Protein 4 Is Physically Associated with Lipoproteins and Governs Plasma Lipid Levels and Adiposity, Journal of Biological Chemistry, 281, 2, (934), (2006).
      • , Does P-Glycoprotein Play a Role in Gastrointestinal Absorption and Cellular Transport of Dietary Cholesterol?, Drug Development and Industrial Pharmacy, 32, 6, (779), (2006).
      • , Improvements in glucose tolerance and insulin sensitivity after lifestyle intervention are related to changes in serum fatty acid profile and desaturase activities: the SLIM study, Diabetologia, 10.1007/s00125-006-0383-4, 49, 10, (2392-2401), (2006).
      • , Identifying regulatory hubs in obesity with nutrigenomics, Current Opinion in Endocrinology and Diabetes, 10.1097/01.med.0000244224.76033.06, 13, 5, (431-437), (2006).
      • , Endocannabinoid activation at hepatic CB1 receptors stimulates fatty acid synthesis and contributes to diet-induced obesity, Journal of Clinical Investigation, 115, 5, (1298), (2005).
      • , Whole-body Insulin Resistance in the Absence of Obesity in FVB Mice With Overexpression of Dgat1 in Adipose Tissue, Diabetes, 54, 12, (3379), (2005).
      • , Influence of outdoor rearing and oleic acid supplementation on lipid characteristics of muscle and adipose tissues from obese Alentejano pigs, Journal of Animal Physiology and Animal Nutrition, , (2017).